Skip to content Skip to navigation menu
cancel
  1. Home
  2. PCR instruments, reagents and consumables
  3. Pathogen detection
  4. Charite-BHQ ValuPanel Reagents
  5. Charite E_Sarbeco Reverse Primer

Charite E_Sarbeco Reverse Primer

Charite E_Sarbeco Reverse Primer

Charite E_Sarbeco Reverse Primer

ATATTGCAGCAGTACGCACACA

Select a delivered amount
TBD
Add to basket to request a quote

Access support

Need some support with placing an order, setting up an account, or finding the right protocol?

Contact us